Skip to main content

Table 1 Primers and profiles used for amplification of pvdhfr gene

From: Mutations of pvdhfr and pvdhps genes in vivax endemic-malaria areas in Kota Marudu and Kalabakan, Sabah

Primer pairs (5′–3′) Concentration of Mg2 (mM) Concentration of primer (nM) Annealing Temperature (°C/Min) Cycle Size (bp)
VDT OF: ATGGAGGACCTTTCAGATGTATTTGACATT
VDT OR: GGCGGCCATCTCCATGGTTATTTTATCGTG
2.0 200 68/2 25 1876
VDT OF: ATGGAGGACCTTTCAGATGTATTTGACATT
VDF OR: CTTGCTGTAAACCAAAAAGTCCA
2.0 400 66/2 30 711
VDF 13NF: GACCTTTCAGATGTATTTGACATTTACGGC
VDF NR58: GGTACCTCTCCCTCTTCCACTTTAGCTTCT
1.5 300 62/2 30 232
VDNF57: CATGGAAATGCAACTCCGTCGATATGATGT
VDF NR: TCACACGGGTAGGCGCCGTTGATCCTCGTG
1.5 400 50/2 30 472
VDT OF: ATGGAGGACCTTTCAGATGTATTTGACATT
VDF NR: TCACACGGGTAGGCGCCGTTGATCCTCGTG
1.0 300 60/2 30 608