Skip to main content

Advertisement

Table 1 List of primers used for plasmid construction

From: A highly infectious Plasmodium yoelii parasite, bearing Plasmodium falciparum circumsporozoite protein

Amplified region Forward primer Reverse primer
PyCSP promoter CTATCAAATAATGTACTGCCCTTAAAAGC GCTAATTTTCTCATCATTTTAAATATGTGTGTGTATATATAAG
PfCSP ORF CATATTTAAAATGATGAGAAAATTAGCTATTTTATCTG aaagtcgacGTTGTTCTTAATGATTCAATGCACGGTG
Three regions of PyCSP gene aaaggatccGTATTGTGAACTTTCCTCATTTATTACG aaagcggccgcCATATTTATGTACACCCTTTTGTGGACC
PyCSP primer forward CTACGTAACAAATATGCAAGATGG  
PyCSP primer reverse   CATATCCTGGAAGTAGAGAATCAAC
PyCSP primer reverse   AGAACCCTTGTGTTTGACGAAC