Skip to main content

Advertisement

Table 1 PCR primer sequences used for the amplification sequence encoding pfcrt

From: Molecular mutation profile of pfcrt in Plasmodium falciparum isolates imported from Africa in Henan province

Gene Primer Sequence (5′–3′) Size (bp)
pfcrt OuterP1 CCGTTAATAATAAATACACGCAG 537
OuterP2 CGGATGTTACAAAACTATAGTTACC
InnerP1 TGTGCTCATGTGTTTAAACTT 145
InnerP2 CAAAACTATAGTTACCAATTTTG