Skip to main content

Table 1 Schematic representation of the Plasmodium ssrRNA genes and nPCR protocol [13]

From: Detection of Plasmodium using filter paper and nested PCR for patients with malaria in Sanliurfa, in Turkey

Species PCR product Primer Sequence Reaction
Plasmodium genus-specific 235 bp rPLU3
rPLU4
TTTTTATAAGGATAACTACGGAAAAGCTGT
TACCCGTCATAGCCATGTTAGGCCAATACC
Nested 2
Plasmodium genus-specific 1.6–1.7 kb rPLU1
rPLU5
TCAAAGATTAAGCCATGCAAGTGA
CCTGTTGTTGCCTTAAACTTC
Nested 1
Plasmodium species-specific
 P. falciparum 206 bp rFAL1
rFAL2
TTAAACTGGTTTGGGAAAACCAAATATATT
ACACAATGAACTCAATCATGACTACCCGTC
Nested 2
 P. malaria 145 bp rMAL1
rMAL2
ATAACATAGTTGTACGTTAAGAATAACCGC
AAAATTCCCATGCATAAAAAATTATACAAA
Nested 2
 P. ovale 226 bp rOVA1
rOVA2
ATCTCTTTTGCTATTTTTTAGTATTGGAGA
ATCTAAGAATTTCACCTCTGACATCTG
Nested 2
 P. vivax 121 bp rVIV1
rVIV2
CGCTTCTAGCTTAATCCACATAACTGATAC
ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
Nested 2