Skip to main content

Advertisement

Table 1 Schematic representation of the Plasmodium ssrRNA genes and nPCR protocol [13]

From: Detection of Plasmodium using filter paper and nested PCR for patients with malaria in Sanliurfa, in Turkey

Species PCR product Primer Sequence Reaction
Plasmodium genus-specific 235 bp rPLU3 rPLU4 TTTTTATAAGGATAACTACGGAAAAGCTGT TACCCGTCATAGCCATGTTAGGCCAATACC Nested 2
Plasmodium genus-specific 1.6–1.7 kb rPLU1 rPLU5 TCAAAGATTAAGCCATGCAAGTGA CCTGTTGTTGCCTTAAACTTC Nested 1
Plasmodium species-specific
 P. falciparum 206 bp rFAL1 rFAL2 TTAAACTGGTTTGGGAAAACCAAATATATT ACACAATGAACTCAATCATGACTACCCGTC Nested 2
 P. malaria 145 bp rMAL1 rMAL2 ATAACATAGTTGTACGTTAAGAATAACCGC AAAATTCCCATGCATAAAAAATTATACAAA Nested 2
 P. ovale 226 bp rOVA1 rOVA2 ATCTCTTTTGCTATTTTTTAGTATTGGAGA ATCTAAGAATTTCACCTCTGACATCTG Nested 2
 P. vivax 121 bp rVIV1 rVIV2 CGCTTCTAGCTTAATCCACATAACTGATAC ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA Nested 2