Skip to main content

Advertisement

Table 1 PCR primer sequences and reaction conditions were used for the amplification of sequences encoding Plasmodium vivax dhfr and dhps gene

From: Low prevalence of dihydro folate reductase (dhfr) and dihydropteroate synthase (dhps) quadruple and quintuple mutant alleles associated with SP resistance in Plasmodium vivax isolates of West Bengal, India

Gene Primer name Primer sequence Product size (bp) PCR cycling conditions
Nest I
 pvdhfr A1F 5′ATGGAGGACCTTTCAGATGTATTTGACATT 3′ 720 105 °C for 5 min; (95 °C for 30 s; 50 °C for 30 s; 72 °C for 50 s) × 30 cycles; 72 °C for 10 min
A1R 5′GGCGGCCATCTCCATGGTTATTTTATCGTG 3′
 pvdhps 2A F 5′ATTCCAGAGTATAAGCACAGCACATTTGAG3′ 840 104 °C for 5 min; (95 °C for 50 s; 57 °C for 1 min; 72 °C for 1 min) × 35 cycles; 72 °C for 10 min
2A R 5′CTAAGGTTGATGTATCCTTGTGAGCACATC 3′
Nest II
 pvdhfr A2F 5′TTTATGATGGAACAAGACTGGGACGTT 3′ 701 100 °C for 5 min; (95 °C for 45 s; 52 °C for 40 s; 72 °C for 1 min) × 32 cycles; 72 °C for 10 min
A2R 5′TCACACGGGTAGGCGCCGTTGATCCTCGTG 3′
 pvdhps 2 B F 5′AATGGCAAGTGATGGGGCGAGCGTGATT 3′ 610 95 °C for 5 min; (94 °C for 40 s; 54 °C for 55 s; 72 °C for 1 min) × 35 cycles; 72 °C for 10 min
2B R 5′CAGTCTGCACTCCCCGATGGCCGCGCCAC 3′