Skip to main content

Table 1 The microsatellites loci used in the study [9, 10]

From: Laboratory rearing of Anopheles arabiensis: impact on genetic variability and implications for Sterile Insect Technique (SIT) based mosquito control in northern Sudan

Locus Foreword primer RM Reverse primer AS
AgXH7 CACGATGGTTTTCGGTGTGG (GT)8 ATTTGAGCTCTCCCGGGTG 99
AgXH180 GTATGTTGTGATCTCCTGCC (GT)10 AAAACGAGCCACCACCAGAG 72
Ag2H175 AGGAGCTGCATAATTCACGC (CA)8 AGAAGCATTGCCCGCATTCC 97
Ag2H1010 GCGTATGTCAATGGCGAGAA (GATA)6 CGCTGGAAATTGTCACACC 117
Ag2H46 CGCCCATAGACAACGAAAGG (GT)8 TGTACAGCTGCAGAACGAGC 138
Ag2H26 GGTTCCTGTTACTTCCTGCC (GT)8 CCGGCAACACAAACAATCGG 154
Ag2H143 CGTACGAGTGAGTGAGTTGG (TC)9 CAAAAATAGCATCACGGCCG 160
Ag3H249 ATGTTCCGCACTTCCGACAC (GT)15 GCGAGCTACAACAATGGAGC 129
Ag3H88 TGCGGCGGTAAAGCATCAAC (GT)9 CCGGTAACACTGCGCCGAC 176
Ag3H93 5′ 8TCCCCAGCTCACCCTTCAAG3′ (GT)4 + 7 3′GGTTGCATGTTTGGATAGCG5′ 209
33C1 5′8TTGCGCAACAAAAGCCCACG3′ (AGC)6 3′ATGAAACACCACGCTCTCGG5′ 159
  1. RM repeat motif, A T annealing temperature, A S expected allele size in bp