Skip to main content

Table 2 Known miRNAs identified in the four life stages libraries of An. funestus

From: Identification and characterization of microRNAs expressed in the African malaria vector Anopheles funestus life stages using high throughput sequencing

miRNA name Sequences Length Location Egg Larva Pupa Unfed adult females
afu-bantam UGAGAUCACUUUGAAAGCUGAU 22 KB669192.1_supercont1.62:255022..255087 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-let-7 UGAGGUAGUUGGUUGUAUAGU 21 KB669047.1_supercont1.49:698595..698654 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-1 UGGAAUGUAAAGAAGUAUGGAG 22 KB668556.1_supercont1.130:34984..35060 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\)
afu-miR-10 ACCCUGUAGAUCCGAAUUUGUU 22 KB668870.1_supercont1.33:182453..182515 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-100 AACCCGUAGAUCCGAACUUGUG 22 KB669047.1_supercont1.49:703012..703075 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-1000 AUAUUGUCCUGUCACAGCAGUA 22 KB669169.1_supercont1.6:205456..205544 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-11 CAAGAACUUGGUACUGUGACCUGUG 25 KB669169.1_supercont1.6:410485..410557 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-1175 AAGUGGAGUAGUGGUCUCAUCGCU 24 KB669358.1_supercont1.77:114656..114718 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-124 UAAGGCACGCGGUGAAUGCCA 21 KB668556.1_supercont1.130:267597..267658 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-125 UCCCUGAGACCCUAACUUGUGAC 23 KB669047.1_supercont1.49:697981..698042 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-133 UUGGUCCCCUUCAACCAGCUGU 22 KB668872.1_supercont1.331:18310..18396 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-137 UAUUGCUUGAGAAUACACGUAG 22 KB669203.1_supercont1.63:461201..461262 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-13b UAUCACAGCCAUUUUGACGA 20 KB668788.1_supercont1.256:85269..85330 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-14 UCAGUCUUUUUCUCUCUCCUAU 22 KB668222.1_supercont1.10:1664927..1664991 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-184 UGGACGGAGAACUGAUAAGGGC 22 KB668984.1_supercont1.432:34990..35049 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-1890 UGAAAUCUUUGAUUAGGUCUGG 22 KB668768.1_supercont1.238:330029..330096 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-1891 UGAGGAGUUAAUUUGCGUGUUU 22 KB668738.1_supercont1.210:313240..313298 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-190 AGAUAUGUUUGAUAUUCUUGGUUG 24 KB668683.1_supercont1.161:159767..159832 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-2-1/2 UAUCACAGCCAGCUUUGAUGAGC 23 KB668788.1_supercont1.256:84051..84114 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-210 CUUGUGCGUGUGACAACGGCUAU 23 KB668844.1_supercont1.306:43398..43456 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-219 AGAGUUGUGACUGGACAUCCGUG 23 KB668767.1_supercont1.237:131113..131179 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-263a AAUGGCACUGGAAGAAUUCACGGG 24 KB668222.1_supercont1.10:692930..692993 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-263b CUUGGCACUGGGAGAAUUCACAG 23 KB668812.1_supercont1.278:190692..190757 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-275 UCAGGUACCUGAAGUAGCGCGCG 23 KB668400.1_supercont1.116:398864..398930 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-276 UAGGAACUUCAUACCGUGCUCU 22 KB668722.1_supercont1.197:198964..199032 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-277 UAAAUGCACUAUCUGGUACGACA 23 KB669169.1_supercont1.6:1092927..1092992 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-278 ACGGACGAUAGUCUUCAACGACC 23 KB668223.1_supercont1.100:30655..30714 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-279 UGACUAGAUCCACACUCAUUAA 22 KB668289.1_supercont1.106:353827..353890 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-281 AAGAGAGCUAUCCGUCGACAGU 22 KB669503.1_supercont1.90:359505..359565 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-282 UAGCCUCUUCUAGGCUUUGUCU 22 KB669503.1_supercont1.90:578663..578726 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-283 AAAUAUCAGCUGGUAAUUCUAGG 23 KB668836.1_supercont1.3:514580..514646 \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\)
afu-miR-286 UGACUAGACCGAACACUCGCGUCCU 25 KB668445.1_supercont1.120:344766..344839 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\)
afu-miR-305 AUUGUACUUCAUCAGGUGCUCUGG 24 KB668400.1_supercont1.116:390085..390147 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-307 UCACAACCUCCUUGAGUGAGCGA 23 KB668223.1_supercont1.100:429991..430050 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\)
afu-miR-308 CGCAGUAUAUUCUUGUGAACUUG 23 KB668933.1_supercont1.387:20015..20073 \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-309 UCACUGGGCAAAGUUUGUCGCA 22 KB668445.1_supercont1.120:344139..344203 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\)
afu-miR-315 UUUUGAUUGUUGCUCAGAAAGCC 23 KB668747.1_supercont1.219:307337..307401 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-317 UGAACACAUCUGGUGGUAUCUCAGU 25 KB669169.1_supercont1.6:1109058..1109126 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-34 UGGCAGUGUGGUUAGCUGGUUGU 23 KB669169.1_supercont1.6:1091079..1091145 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-375 UUUGUUCGUUUGGCUCGAGUUA 22 KB669281.1_supercont1.70:314839..314901 \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-7 UGGAAGACUAGUGAUUUUGUUGUU 24 KB668798.1_supercont1.265:312209..312271 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-79 AUAAAGCUAGAUUACCAAAGCAU 23 KB668930.1_supercont1.384:9585..9649 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-8 UAAUACUGUCAGGUAAAGAUGUC 23 KB668666.1_supercont1.146:27512..27573 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-87 CCAGCCUGAAAUUUGCUAAACCU 23 KB669058.1_supercont1.5:469321..469384 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-927-5p UUUAGAAUUCCUACGCUUUACC 22 KB668660.1_supercont1.140:64296..64359 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-929 AAAUUGACUCUAGUAGGGAGU 21 KB668836.1_supercont1.3:1318319..1318378 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-92a UAUUGCACUUGUCCCGGCCUAU 22 KB668836.1_supercont1.3:1691007..1691065 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-92b AAUUGCACUUGUCCCGGCCUGC 22 KB668836.1_supercont1.3:1704691..1704754 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-957 UGAAACCGUCCAAAACUGAGGC 22 KB669514.1_supercont1.91:212823..212889 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-970 UCAUAAGACACACGCGGCUAU 21 KB668797.1_supercont1.264:230410..230478 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-981 UUCGUUGUCGACGAAACCUGCA 22 KB668389.1_supercont1.115:58097..58172 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\surd\) \(\times\)
afu-miR-988 CCCCUUGUUGCAAACCUCACGC 22 KB669391.1_supercont1.8:63805..63867 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\)
afu-miR-993 GAAGCUCGUUUCUAUAGAGGUAUC 24 KB668870.1_supercont1.33:220731..220822 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-996 UGACUAGAUUACAUGCUCGUCU 22 KB668289.1_supercont1.106:354280..354344 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-9a UCUUUGGUUAUCUAGCUGUAUGA 23 KB668816.1_supercont1.281:204094..204152 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-mir-9b ACUUUGGUGAUUUAGCUGUAUGU 23 KB668930.1_supercont1.384:9150..9215 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\)
afu-miR-9c UCUUUGGUAUUCUAGCUGUAGA 22 KB668930.1_supercont1.384:12370..12438 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\)
afu-miR-iab-4 ACGUAUACUGAAUGUAUCCUGA 22 KB668694.1_supercont1.171:357100..357157 \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-12 UGAGUAUUACAUCAGGUACUGGU 23 Unknown \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-306 UCAGGUACUGGAUGACUCUCAG 22 Unknown \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-mir-965 UAAGCGUAUAGCUUUUCCCAUU 22 Unknown \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-989 UGUGAUGUGACGUAGUGGUAC 21 Unknown \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-1174 UCAGAUCUACUUCAUACCCAUG 22 Unknown \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
afu-miR-1889 ACACAUUACAGAUUGGGAUUA 21 Unknown \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\)
  1. The three columns for each life stage correspond to detection of the full precursor structure namely mature, loop and star sequence, respectively. \(\surd\) \(\surd\) \(\surd\) indicates that miRNA full precursor structure was detected in the library where \(\times\) \(\times\) \(\times\) indicates the the miRNA was not detected in the library