Skip to main content

Table 3 Novel miRNAs identified in the four life stages libraries of An. funestus

From: Identification and characterization of microRNAs expressed in the African malaria vector Anopheles funestus life stages using high throughput sequencing

miRNA name Sequences Length Location Egg Larva Pupa Unfed adult females Description  
afu-miR-2-3 UAUCACAGCCAGCUUUGAAGAGC 23 KB668788.1_supercont1.256:85435..85508 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-2a Identified in An. anthropophagus and An. gambiae [53, 100]
afu-miR-252 CUAAGUACUAGUGCCGCAGGAG 22 KB669170.1_supercont1.60:199766..199821 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) dme-miR-252-5p Identified in An. anthropophagus and An. gambiae [53, 100]
afu-miR-932 UCAAUUCCGUAGUGCAUUGCAGU 23 KB668896.1_supercont1.353:66093..66159 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) tca-mir-932 Identified in An. anthropophagus and An. gambiae [53, 100]
afu-miR-2796 GUAGGCCGGCGGAAACUACUUGC 23 KB669425.1_supercont1.83:106051..106111 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) bmo-miR-2796-3p Identified in An. anthropophagus and An. gambiae [53, 100]
afu-miR-971 UUGGUGUUAUAUCUUACAGUGAG 23 KB669081.1_supercont1.52:713511..713586 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) ame-miR-971 Identified in An. gambiae [53]
afu-miR-998 UAGCACCAUGAGAUUCAGCUC 21 KB669169.1_supercont1.6:410177..410245 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) aae-miR-998 Identified in An. gambiae [53]
afu-mir-2942 UAUUCGAGACCUUCACGAGUUAA 23 KB668333.1_supercont1.11:1154487..1154559 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) aae-miR-2942 Identified in An. gambiae [53]
afu-miR-31 UAGCUAUUCAACUUCUUGUUUAU 23 KB668245.1_supercont1.102:383384..383442 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) cqu-miR-31-3p Identified in An. gambiae [100]
afu-mir-33 GUGCAUUGUAGUUGCAUUGCA 21 KB668389.1_supercont1.115:38232..38297 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-33 Identified in An. gambiae [100]
afu-miR-285 UAGCACCAUUCGAAAUCAGUAC 22 KB668666.1_supercont1.146:348761..348825 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-285 Identified in An. gambiae [100]
afu-miR-980-5p CGGUCGUUCACCAGGUCAUCUAGC 24 KB668730.1_supercont1.203:371780..371842 \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) aae-miR-980-5p Identified in An. gambiae [100]
afu-miR-999 UGUUAACUGUAAGACUGUGUCU 22 KB668862.1_supercont1.322:158491..158552 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) aae-miR-999 Identified in An. gambiae [100]
afu-miR-2940 GUCGACAGAGAGAUAGAUCACU 22 KB668668.1_supercont1.148:483999..484065 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-2940 Identified in An. gambiae [100]
afu-miR-2944a GAAGGAACUUCUGCUGUGAUCU 22 KB668445.1_supercont1.120:344303..344359 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-2944a-5p Identified in An. gambiae [100]
afu-miR-2944b GAAGGAACUCCCGGUGUGAUAUA 23 KB668456.1_supercont1.121:76523..76595 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-2944b-5p Identified in An. gambiae [100]
afu-miR-71 UCUCACUACCUUGUCUUUCAUG 22 KB668788.1_supercont1.256:83429..83494 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) aae-miR-71-3p Novel in Anopheles spp.
afu-miR-193 UACUGGCCUACUAAGUCCCAAC 22 KB668718.1_supercont1.193:152692..152757 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) aae-miR-193 Novel in Anopheles spp.
afu-miR-316 UGUCUUUUCCUGCUUACUGCCG 22 KB668714.1_supercont1.19:760291..760355 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) aae-miR-316 Novel in Anopheles spp.
afu-miR-927-3p UAAAGCGUAGGAAUUCUAAAAC 22 KB668660.1_supercont1.140:64294..64357 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) dme-miR-927-5p Novel in Anopheles spp.
afu-miR-980-3p UAGCUGCCUAGUGAAGGGC 19 KB668730.1_supercont1.203:371784..371839 \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) aae-miR-980-3p Novel in Anopheles spp.
afu-miR-2765 UGGUAACUCCACCACCGUUGGC 22 KB668981.1_supercont1.43:346454..346513 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) aae-miR-2765 Novel in Anopheles spp.
afu-miR-2941 UAGUACGGAUAAGUAACACACU 22 KB668992.1_supercont1.44:163365..163440 \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) aae-miR-2941 Novel in Anopheles spp.
afu-miR-2943 UUAAGUAGGCACUUGCAGGCAA 22 KB668790.1_supercont1.258:358408..358469 \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) aae-miR-2943 Novel in Anopheles spp.
afu-miR-a UGAGGUAAACCGCGCUUAAAGA 22 KB668367.1_supercont1.113:186839..186900 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-b AACGGACGGGUACCUUCGCACC 22 KB668478.1_supercont1.123:544003..544072 \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-c UCAACAUACAUUCUCGUUCUGU 22 KB668522.1_supercont1.127:174494..174560 \(\times\) \(\times\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-d UAAUACAUUUGCUUACGGCAGAGU 24 KB668522.1_supercont1.127:49592..49655 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-e UCUGCCGUAGGAAUGUAUUUACC 23 KB668522.1_supercont1.127:51191..51253 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) - Novel
afu-miR-f UGCUGUAGGAAGUGAUUUACCU 22 KB668522.1_supercont1.127:51545..51607 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) - Novel
afu-miR-g AGUCAUCGUCGUCACUCGAUCGA 23 KB668728.1_supercont1.201:241585..241642 \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) - Novel
afu-miR-h CCAUCUGACGGACACCACCGGA 22 KB668739.1_supercont1.211:143895..143961 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-i AUGGCAGUCAACGUAUACCCAUU 23 KB668781.1_supercont1.25:515317..515377 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) - Novel
afu-miR-j UUCCGAGUGGACAAGUGGAACCU 23 KB668806.1_supercont1.272:68360..68416 \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-k UACCUGAGUUCGUUUAAACUGA 22 KB668821.1_supercont1.286:244740..244793 \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) - Novel
afu-miR-l UCUAUCAUUUGAGUACCAUGA 21 KB668837.1_supercont1.30:192923..192989 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) - Novel
afu-miR-m CUAACCUGUAAGGAGCUUUGGCGGC 25 KB668906.1_supercont1.362:184842..184933 \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) - Novel
afu-miR-n AUGGCACAAGCAACAUCAGCUG 22 KB668909.1_supercont1.365:72126..72172 \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) - Novel
afu-miR-o UCUUGAGCGUAUUUGGCACUGCU 23 KB668992.1_supercont1.44:163580..163641 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\surd\) \(\times\) \(\times\) - Novel
afu-miR-p UAGCUCAACAAACAUCUGGAGGA 23 KB669059.1_supercont1.50:521609..521669 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) - Novel
afu-miR-q UACAACCGGACGGUACACUGCAUAG 25 KB669214.1_supercont1.64:671164..671237 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-r AACGAAGUUGAUCCGCUGAAGCU 23 KB669480.1_supercont1.88:541508..541571 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-s ACUUGAAACGUAGUCCGGGAACCC 24 KB669502.1_supercont1.9:563831..563898 \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) \(\times\) - Novel
afu-miR-t AUUAGAAUGUGGAAUCUGUUUUU 23 KB668820.1_supercont1.285:93655..93723 \(\surd\) \(\surd\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) \(\surd\) \(\times\) \(\surd\) - Novel
  1. The three columns for each life stage correspond to detection of the full precursor structure namely mature, loop and star sequence, respectively. \(\surd\) \(\surd\) \(\surd\) indicates that miRNA full precursor structure was detected in the library where \(\times\) \(\times\) \(\times\) indicates the the miRNA was not detected in the library