Table 1 Primers for amplification of the region of PfCRT 76
From: The return of chloroquine-susceptible Plasmodium falciparum malaria in Zambia
Codon | Primer | Sequence (5′–3′) | Bases | Amplicon size |
|---|---|---|---|---|
72–97 | External forward | GACCTTAACAGATGGCTCAC | 20 | 347 bp |
| Â | External reverse | TTTTATATTGGTAGGTGGAATAG | 23 | Â |
| Â | Internal forward | Biotin-GGTAAATGTGCTCATGTGTTTAAACTTATT | 30 | 241Â bp |
| Â | Internal reverse | TTACTTTTGAATTTCCCTTTTTATTTCCA | 29 | Â |
72–76 | Pyrosequencing primer | AGTTCTTTTAGCAAAAATT | 19 |  |