Skip to main content

Table 1 Primers

From: Surveillance for sulfadoxine-pyrimethamine resistant malaria parasites in the Lake and Southern Zones, Tanzania, using pooling and next-generation sequencing

Primer Sequence Descrpition
Pfdhfr-F1 TCCTTTTTATGATGGAACAAG dhfr outer forward
Pfdhfr-R1 AGTATATACATCGCTAACAGA dhfr outer reverse
Pfdhfr1-F TGAGGTTTTTAATAACTACACATTTAGAGGTCT dhfr inner forward
Pfdhfr1-R TCGCTAACAGAAATAATTTGATACTCAT dhfr inner reverse
Pfdhps-F1 AACCTAAACGTGCTGTTCAA dhps outer forward
Pfdhps-R1 AATTGTGTGATTTGTCCACAA dhps outer reverse
Pfdhps1-F TGAAATGATAAATGAAGGTGCTAGTGT dhps inner forward
Pfdhps1-R GTTGTGTATTTATTACAACATTTTGATCATTC dhps inner reverse