Skip to main content

Table 1 Primer sequences for recombineering

From: New adenovirus-based vaccine vectors targeting Pfs25 elicit antibodies that inhibit Plasmodium falciparum transmission

Primer name Sequence
Primers for galk insertion
 HVR1 galk forward gtgccccaaatccttgcgaatgggatgaagctgctactgctcttgaaatacctgttgacaattaatcatcggca
 HVR1 galk reverse agaataaggcgcctgcccaaatacgtgagttttttgctgctcagcttgcttcagcactgtcctgctcctt
 HVR5 galk forward agcaacaaaatggaaagctagaaagtcaagtggaaatgcaatttttctcacctgttgacaattaatcatcggca
 HVR5 galk reverse gtgtctggggtttctatatctacatcttcactgtacaataccactttaggtcagcactgtcctgctcctt
Primers for pfs25 epitope insertion
 HVR1 DIII forward gtgccccaaatccttgcgaatgggatgaagctgctactgctcttgaaataatctggatacatctaatcccgtgaagactggagtctgcagt
 HVR1 DIII reverse agaataaggcgcctgcccaaatacgtgagttttttgctgctcagcttgctcacaactgcagactccagtcttcacgggattagatgtatc
 HVR5 pfsDII forward agcaacaaaatggaaagctagaaagtcaagtggaaatgcaatttttctcaattgatgggaacccagtgtcctacgcctgcaagtgtaat
 HVR5 pfsDII reverse gtgtctggggtttctatatctacatcttcactgtacaataccactttaggattacacttgcaggcgtaggacactgggttcccatcaat
 HVR5 pfsDIII forward agcaacaaaatggaaagctagaaagtcaagtggaaatgcaatttttctcactggatacatctaatcccgtgaagactggagtctgcagt
 HVR5 pfsDIII reverse Gtgtctggggtttctatatctacatcttcactgtacaataccactttaggacaactgcagactccagtcttcacgggattagatgtatc