Skip to main content

Table 1 Primers used for genotyping in Fig. 6

From: Generation of transgenic rodent malaria parasites by transfection of cell culture-derived merozoites

Primer Sequence (5′–3′)
1 GTGTAGTAACATCAGTTATTGTGTG
2 ATACTGTATAACAGGTAAGCTGTTATTGTG
3 TTTCCCAGTCACGACGTTG
4 CTTAGTGTTTTGTATTAATGTCGATT TG
QCR2 AGGGGCAAATACCAAAGTTGTGT
QCR1 ACGCATATTCACGAGTTTCACA
GW2 CTTTGGTGACAGATACTAC