Skip to main content

Table 3 Microsatellite markers used in this study, repeated pattern (RP) from Zheng et al. [50] and characteristics (allele size, AS; annealing temperature, Ta)

From: The implementation of long-lasting insecticidal bed nets has differential effects on the genetic structure of the African malaria vectors in the Anopheles gambiae complex in Dielmo, Senegal

Marker locus RP Sequence primer flanking AS (bp) Ta (°C) An. coluzzii (N = 119) An. gambiae (N = 82) An. arabiensis (N = 309)
Na A Na A Na A
H59 (GT)9 5′ CCCCTATTAAACCCTGGACG 3′
3′ TGTTGTTGCCCTGCGTTACC 5′
123 55 10 6.75 ± 1.71 7 6.00 ± 1.00 13 7.33 ± 1.50
H88 (GT)9 5′TGCGGCGGTAAAGCATCAAC 3′
3′ CCGGTAACACTGCGCCGAC 5′
176 60 NPA NPA NPA NPA 23 13.44 ± 3.05
H93 (GT)4 + 7 5′ TCCCCAGCTCACCCTTCAAG 3′
3′ GGTTGCATGTTTGGATAGCG 5′
209 55 19 10.75 ± 3.86 20 12.67 ± 0.58 30 13.00 ± 3.81
H119 (GT)6 5′ GGTTGATGCTGAAGAGTGGG 3′
3′ ATGCCAGCGGATACGATTCG 5′
174 55 17 12.25 ± 1.26 14 10.67 ± 0.58 10 6.89 ± 1.69
H128 (GT)21 5′ CGGGACGGCTAGATAAAGCG 3′
3′ CCGGGCGACATAACCCACCC 5′
117 55 25 17.5 ± 3.42 24 16.67 ± 3.22 b b
H242 (GT)8 5′TTCATTTCCACCGCAGCTGC 3′
3′GGCGACACTCAATCCTTCC 5′
69 58 7 5.50 ± 1.00 7 5.67 ± 0.58 c c
H249 (GT)15 5′ ATGTTCCGCACTTCCGACAC 3′
3′ GCGAGCTACAACAATGGAGC 5′
129 60 22 13.50 ± 1.73 17 12.33 ± 1.16 27 12.67 ± 2.69
H312 (GT)10 5′ TAAACCATCAACCAGCCACC 3′
3′ ACTGTGTGCGAGTCGGTTGG 5′
108 58 19 12.75 ± 1.50 16 13.00 ± 0.00 29 15.33 ± 4.79
H555 (GT)8 5′GCAGAGACACTTTCCGAAAC3′
3′ TGTCAACCCACATTTTGCGC 5′
81 55 17 10.50 ± 3.00 15 9.67 ± 3.06 b b
H577 (GT)16 5′ TTCAGCTTCAGGTTGGTCTC 3′
3′ GGGTTTTTTGGCTGCGACTG 5′
113 55 13 8.50 ± 2.65 14 10.00 ± 1.00 22 10.78 ± 3.31
H746 (GT)14 5′ TGGGTTCGAAATTCGCCAAC 3′
3′ GACGTGTGCACCCGTTGTG 5′
105 58 14 11.25 ± 1.26 13 10.67 ± 1.16 29 16.89 ± 2.57
H758 (GT)11 5′ TGATTTGCCAGTTCTGCCAG 3′
3′ GTGATTGGAGTGGCTAGTGG 5′
105 60 a a a a 11 5.11 ± 0.93
H812 (GT)10 5′CTGGCCCATTTTGCATATGC 3′
3′ TGCTCCACCAAACCACATC 5′
131 55 a a a a 15 10.00 ± 1.58
H817 (GT)8 5′ ACTGGTCCGTTGCTGCGCG 3′
3′ ATGAGTGAATGGTGCGCTGG 5′
124 58 7 6.00 ± 0.82 6 5.00 ± 1.00 b b
Mean      15.46 ± 5.87 10.48 ± 3.89 13.91 ± 5.59 10.21 ± 3.76 20.90 ± 7.56 11.14 ± 4.14
  1. Parameters of polymorphism for An. gambiae, An. coluzzii and An. arabiensis populations are given: number of observed alleles (Na), mean number of alleles per locus (A), number of specimens used (N)
  2. aNull alleles in An. gambiae and An. coluzzii; b null alleles in An. arabiensis, c monomorphic locus, not used in the study, NPA not properly amplified