Skip to main content

Advertisement

Table 1 Primers used for amplification of haemosporidian cytochrome b gene

From: Carrion crows (Corvus corone) of southwest Germany: important hosts for haemosporidian parasites

PCR (5′–3′) nested PCR (5′–3′)
CytF1: GCCTAGACGTATTCCTGATTATCC CytFN: GCTTTAAATGGTTGGAATATG
CytR1: CATAATTATAACCTTACGGTCTG CytRN: GTTTGCTTGGGAGCTGTAATC
HaemNF: CATATATTAAGAGAATTATGGAGa HaemF: AATGGTGCTTTCGATATATGCATGb
HaemNR2: AGAGGTGTAGCATATCTATCTACa HaemR2: GCATTATCTGGATGTGATAATGGTb
  LeucoF: CCCATTCGTAGCATTAGC
  1. aPreviously designed by [23]
  2. bPreviously designed by [24]