Skip to main content

Table 1 Primers used in this study

From: Species and genotype diversity of Plasmodium in malaria patients from Gabon analysed by next generation sequencing

Primer name 5′–3′ sequencea Annealing (°C)
SSU-Fwd AAGACTCGGCAGCATCTCCAGTGAAATTCTTAGATTTTCTG 58
SSU-Rev GCGATCGTCACTGTTCTCCACGTGTTGAGTCAAATTAAGC
Cyt-Fwd AAGACTCGGCAGCATCTCCAGAGTGGATGGTGTTTTAGAT 58
Cyt-Rev GCGATCGTCACTGTTCTCCAGTGCTACCATGTAAATGTAA
Clpc-Fwd AAGACTCGGCAGCATCTCCAGGTCAATTAACAGAACAA 55
Clpc-Rev GCGATCGTCACTGTTCTCCATAGTTAATCTATTTAATAATTC
rPLU6b TTAAAATTGTTGCAGTTAAAACG  
rPLU5b CCTGTTGTTGCCTTAAACTTC  
p-AVL-F GGAATGACAATGTCGTAAAACAAAGTAT  
P-AVL-R ATACTTTGTTTTACGACATTGTCATTCC
  1. aUnderlined region represents universal tag sequences
  2. bSnounou et al. [25]