Skip to main content

Table 1 Primers used

From: Plasmodium falciparum genetic variation of var2csa in the Democratic Republic of the Congo

Forward primer Reverse primer
ATCATGGTGGAACACGAACA GTACCCGCTTTACGGTTTCG