Skip to main content

Table 2 Primers used to amplify the exons of RNASE3 by polymerase chain reaction (PCR)

From: Genetic variants of RNASE3 (ECP) and susceptibility to severe malaria in Senegalese population

Primers Sequence (5′ > 3′)
RNASE3PromPF GACAACCCCAGAACACACTG
RNASE3PromPR AAGTGGGTCTCAGGTCTAGG
RNASE3Ex1PF ACTATGCCTGCCTTCGTGTC
RNASE3Ex1PR TTCCTTTACGCTGGGGTCTC
RNASE3Ex2PF AACAATCCCCAGAGCTGGGA
RNASE3Ex2PR GAGGGGGAGTTATAGACTGG