Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Published pfhrp2/3 primer sequences, limits of detection, and optimized conditions

From: Streamlined, PCR-based testing for pfhrp2- and pfhrp3-negative Plasmodium falciparum

Assay # Target Primer sequences (5′→3′) Reaction conditions Cycling parameters LOD,* ng/µL (genomes/µL) Ref
1 pfhrp2 (exon 1/2) Outer:
 For: GGTTTCCTTCTCAAAAAATAAAG
 Rev: TCTACATGTGCTTGAGTTTCG
Optional—inner:
 For: GTATTATCCGCTGCCGTTTTTGCC
 Rev: CTACACAAGTTATTATTAAATGCGGAA
200 nM each primer
HotStarTaq MM (Qiagen, Venlo, Netherlands)
3 μL template DNA or 100 × diluted first-round product
25 μL reaction vol
95 °C × 15 min; 40 cycles of 94 °C × 1 min, 50 °C × 1 min for outer primers or 55 °C × 1 min for inner primers, 60 °C × 1 min; 60 °C × 10 min 10−5 (~ 0.4) [3]
2 pfhrp2 (exons 1/2) For: TATCCGCTGCCGTTTTTGCC
Rev: AGCATGATGGGCATCATCCTA
400 nM each primer HotStarTaq MM
3 μL template DNA
25 μL reaction vol
95 °C × 15 min; 40 cycles of 94 ° × 1 min, 57 °C x 1 min, 60 °C × 1 min; 60 °C × 10 min 10−1 (~ 4000) [9]
3 pfhrp2 (exon 2) For: ATTCCGCATTTAATAATAACTTGTGTAGC
Rev: ATGGCGTAGGCAATGTGTGG
400 nM each primer
HotStarTaq MM
3 μL template DNA
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 59 °C × 1 min, 72 °C × 1 min;
72 °C × 10 min
10−4 (~ 4) [5]
4 pfhrp2 (exon 2) Outer:
 For: CAAAAGGACTTAATTTAAATAAGAG
 Rev: AATAAATTTAATGGCGTAGGCA
Optional—inner (hemi-nested):
 For: ATTATTACACGAAACTCAAGCAC
 Rev: AATAAATTTAATGGCGTAGGCA
400 nM each primer
HotStarTaq MM
3 μL template DNA or 100× diluted first-round product
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 57 °C × 1 min for outer primers or 62 °C for inner primers, 60 °C × 1 min;
60 °C × 10 min
10−4 (~ 4) [23]
5 pfhrp3 (exons 1/2) For: TATCCGCTGCCGTTTTTGCTTCC
Rev: TGCATGATGGGCATCACCTG
400 nM primers
HotStarTaq MM
3 μL template DNA
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 60 °C × 1 min, 60 °C × 1 min;
60 °C × 10 min
10−4 (~ 4) [9]
6 pfhrp3 (exon 2) Outer:
For: AATGCAAAAGGACTTAATTC
Rev: TGGTGTAAGTGATGCGTAGT
Optional—inner (hemi-nested):
 For: AAATAAGAGATTATTACACGAAAG
 Rev: TGGTGTAAGTGATGCGTAGT
400 nM primers
HotStarTaq MM
3 μL template DNA or 100 × diluted first-round product
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 55 °C × 1 min, 60 °C × 1 min;
60 °C × 10 min
10−4 (~ 4) [23]
7 pfldh (initial qPCR) For: ACGATTTGGCTGGAGCAGAT
Rev: TCTCTATTCCATTCTTTGTCACTCTTTC
Probe: FAM-GTAATAGTAACAGCTGGATTTACCAAGGCCCCA-TAMRA
200 nM primers
100 nM probe
Probe Master qPCR Mix (Roche Diagnostics, Indianapolis, IN)
2 μL template DNA
12 μL reaction vol
50 °C × 2 min;
95 °C × 10 min;
40 cycles of 95 °C × 15 s, 60 °C × 1 min
10−4 (~ 4) [31]
8 Pf -tubulin (confirmatory) For: AATAAATCATAATGATGTGCGCAAGTGATCC
Rev: AATAAATCATAATCCTTTGTGGACATTCTTCCTC
300 nM primers
FastStart Universal SYBR Green MM (Roche Diagnostics)
3 µL template DNA
25 µL reaction volume
50 °C × 2 min;
95 °C × 10 min;
40 cycles of 95 °C × 15 s, 60 °C × 1 min;
Dissociation analysis
10−3 (~ 40) [32, 33]
  1. LOD lower limit of detection; MM master mix; Vol volume; Bp base pair
  2. * Typical LOD under the conditions of this laboratory. Assay performance varied between runs, but consistently achieved LODs within one log10 of the listed LOD