Skip to main content

TableĀ 2 Primers in construction of His-tagged recombinant proteins and expression plasmid

From: Identification and characterization of DNA endonucleases in Plasmodium falciparum 3D7 clone

Genes ID Primers Recombinant plasmid
PF3D7_1238600 Forward primer GGATCC TATGATATTGATATATTAGTTCT pET-28a
Reverse primer CTCGAG ATTTGCAACTAGGATATAATCTA
PF3D7_0107200 Forward primer GGATCC TTTAATAGCGCTTGGTATACA pET-28a
Reverse primer CTCGAG ATGATCTGATGGGAAATGCTC
PF3D7_1363500 Forward primer GGATCC ATACCTTCTGTGCGTAATATAAA pET-28a
Reverse primer CTCGAG TAAGAGCTCAAATACTTTGG
PF3D7_0305600 Forward primer GGATCC AATAATAATTCTCCCTTTAGTCA pET-28a
Reverse primer CTCGAG TAAACTAAAATAAGCATTATAATC
PF3D7_0319200 Forward primer GGATCC AAAAGTTATACATTTCCATATATA pET-28a
Reverse primer TCTGAG TAAAAGCTTTAATTCCTTGTGAT