Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

TableĀ 3 Primers in construction of GST-tagged recombinant proteins and expression plasmid

From: Identification and characterization of DNA endonucleases in Plasmodium falciparum 3D7 clone

Genes ID Primers Recombinant plasmid
PF3D7_1238600 Forward primer GGATCC TATGATATTGATATATTAGTTCT pGEX-4T-1
Reverse primer CTCGAG ATTTGCAACTAGGATATAATCTA
PF3D7_0107200 Forward primer GGATCC TTTAATAGCGCTTGGTATACA pGEX-4T-1
Reverse primer CTCGAG ATGATCTGATGGGAAATGCTC
PF3D7_1363500 Forward primer GGATCC AAGGAATTTTCCGTTTTCTCTTT pGEX-4T-1
Reverse primer CTCGAG GTACGAATAAAATATATAATCTACAC
PF3D7_0305600 Forward primer GGATCC ATTATTGTTACATGGAATATGAAT pGEX-4T-1
Reverse primer CTCGAG TTCATTTTTGAGGTATAATATAAC
PF3D7_0319200 Forward primer GGATCC CGTATTCTATCGTATAATATTTTAGCA pGEX-4T-1
Reverse primer CTCGAG TAATTCTACCTCAGCAGCTATG