Skip to main content

Table 1 Primer sequences for LAMP amplification of the Plasmodium genus for detection of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and Plasmodium malariae

From: Evaluation of loop-mediated isothermal amplification as a surveillance tool for malaria in reactive case detection moving towards elimination

Species Primer Primer sequence (5′ to 3′)
P. falciparum, P. vivax, P. ovale, P. malariae) Forward Inner Primer (F1P) (F1c + F2 regions) AGCTGGAATTACCGCGGCTGGGTTCCTAGAGAAACAATTGG
Backward Inner Primer (B1P) (B1-B2c regions) TGTTGCAGTTAAAACGTTCGTAGCCCAAACCAGTTTAAATGAAAC
Forward Outer Primer (F3) (F3c + F3 region) TGTAATTGGAATGATAGGAATTTA
Backward Outer Primer (B3) (B3 + B3c region) GAAAACCTTATTTTGAACAAAGC
Loop Forward Primer (LPF) GCACCAGACTTGCCCT
Loop Backward Primer (LPB) TTGAATATTAAAGAA