Skip to main content

Table 1 Primers and Probes

From: Bead-based assays to simultaneously detect multiple human inherited blood disorders associated with malaria

Genomic PCR primer  
  G202A Fw 5′GTGACCTGGCCAAGAAGAAG3′
G6PD gene G202A Rv 5′AGGGAGGGAGGCCAAAG3′
  A376G Fw 5′ACACACGGACTCAAAGAGAGG3′
  A376G Rv 5′GGGTCTGAGTGGCCTGAAG3′
HBB gene HBB Fw 5′GAGATATATCTTAGAGGGAGGGC3′
  HBB Rv 5′TTTCCCATTCTAAACTGTACCCTGT3′
ASPE probes Sequence Bead set
202G 5′CTAAATCACATACTTAACAACAAACCGAAAACACCTTCATCG3′ MTAG-A063
202A 5′ATACTTTACAAACAAATAACACACCCGAAAACACCTTCATCA3′ MTAG-A019
376A 5′TTAACAACTTATACAAACACAAACGCCTCAACAGCCACATGA3′ MTAG-A053
376G 5′ATCTCAATTACAATAACACACAAAGCCTCAACAGCCACATGG3′ MTAG-A067
HbA (C) 5′CTTAAACTCTACTTACTTCTAATTCATGGTGCATCTGACTCCTG3′ MTAG-A056
HbC 5′AACTTTCTCTCTCTATTCTTATTTCATGGTGCATCTGACTCCTA3′ MTAG-A043
HbA (S) 5′CTAAACATACAAATACACATTTCACAGTAACGGCAGACTTCTCCT3′ MTAG-A062
HbS 5′AATCAACACACAATAACATTCATACAGTAACGGCAGACTTCTCCA3′ MTAG-A048
  1. PCR primer sequences and allele specific primer extension (ASPE) probe details. The top of the table contains the primers for genomic PCR amplification and the bottom part of the table contains the ASPE probes. The probe sequence that is complimentary to the anti-tag sequence coupled to the magnetic beads is highlighted in bold. The bead sets were chosen according to the Tag-It® Oligo Design Software v.3.00 (courtesy of Luminex corp., USA)