Skip to main content

Table 1 Sequences of primers and probes for Plasmodium PCR

From: Investigation of a possible malaria epidemic in an illegal gold mine in French Guiana: an original approach in the remote Amazonian forest

Plasmodium species Genes Acess number Sens Sequencies (5′ → 3′)
Falciparum AQP AJ413249 F TTTATGTATTGGTATAACATTCGG
R GGCAAATAACTTTATCATAGAATTGAC
P TACACTACCAACACATGGGGCTACAAGAGGT
Vivax EACPR PVX_113890 F GTGGCCGCCTTTTTGCT
R CCTCCCTGAAACAAGTCATCG
P CATCTACGTGGACAACGGGCTCAACA
Malariae CS S69014 F GAGGAATGGTCACCATGTAGTGT
R CAAATTTCAGTTTCAAGGTCACTTAA
P ATTTTTTATCAACCTTTCTTCTAGCCC
Ovale Pos25 AB074976 F CCAAGCCCAGATAATAAGGAAGGT
R TTCGTGCACTTCAACTTACATTCAGT
P TTATTGTCCTCTGGGTTTGGAACTTTGCC