Skip to main content

Table 1 Sequence specific oligonucleotide primers, probes and temperature profiles for Pvkelch12 and Pvpm4 genes

From: Polymorphisms in Pvkelch12 and gene amplification of Pvplasmepsin4 in Plasmodium vivax from Thailand, Lao PDR and Cambodia

Gene Method Fragment Primer name Sequence (5′–3′) PCR condition
Annealing Temperature (°C) MgCl2 (mM) No. of PCR cycle Estimated PCR product Size (bp)
Pvkelch12 PCR Nest 1 K12_F1-F CCATACGTAAACGCTGCAAAT 58 2 25 2139
K12_c.2216R CTCCCCATCTGTTCCATGTC
F1 K12_F1-F CCATACGTAAACGCTGCAAAT 58 2 30 980
K12_F1-R* TTCTTAATTTGTTTATACCCGTTTGA
F2 K12_F2-F CAAGCTTTTTAAAGACAAAAAGGAA 58 2 30 728
K12_F2-R* CAGTTTCGAAAAGGGCTTTATAATC
F3 K12_c.1304F* TGGTTTCGATGGGGTAGAGT 58 2 30 912
K12_c.2216R CTCCCCATCTGTTCCATGTC
Pvpm4 PCR Nest 1 PV_PM4F1_F TCAAAAGGAGTACGAAGCATACAA 62 2 30 1703
PV_PM4F2_R TGTTCTAATTACAGCACCAACACA
F1 PV_PM4F1_F* TCAAAAGGAGTACGAAGCATACAA 62 2 30 807
PV_PM4F1_R* ATGGGTTCTAAATCATCAGTGTCA
F2 PV_PM4F2_F* GATGCAGCATTAAAAATCTGTACG 62 2 30 1086
PV_PM4F2_R TGTTCTAATTACAGCACCAACACA
Pvpm4 Vector-based
primer
Pvpm4 CPvPM4-F*
CPvPM4-R*
AAAATCGAGAGACCCTATGACAAG
ATGGGTTCTAAATCATCAGTGTCA
62 2 35 461
Pv β-tubulin CPvtubulin-F* AAATTAGGGAAGAATACCCAGACC 62 2 35 451
CPvtubulin-R* TCACTTGCACACATCATATTCTTG
Pvpm4 Real-time PCR Pvpm4 Pvpm4_F(CNV)
Pvpm4_R(CNV)
PvPm4_Probe(CNV)
ACCACCAAAAGTTTATGCTCATC
CGTAAGACTTAGACTTGCTAGAGTCG
6FAM-CAAAAAATGCAATAGCAGCGGA-TAMRA
58 50 133
Pv β-tubulin PvTubulin_F(CNV)
PvTubulin_R2(CNV)
PvTubulin_Probe(CNV)
GATAATGAGGCCTTGTATGATATTT
AGGAAATCTTAACGAACATGTAACT
HEX-TGGTTTCTGCTGCCATGTCAGG-TAMRA
58 50 123