Evidence of asymptomatic submicroscopic malaria in low transmission areas in Belaga district, Kapit division, Sarawak, Malaysia

Table 2 List of primers including name, nucleotide sequence, final concentration, PCR step, fragment size and specificity of the NM-PCR [13,14,15]

Name	Sequence 5′-3′	Final concentration (μM)	PCR (T^a)	Size^a (bp)	Specificity
PLF	AGTGTGTATCAATCGAGTTTC	0.0375	1° PCR 58 °C	783–821^b	Plasmodium
REV	GACGGTATCTGATCGTCTTC	0.0375	1° PCR 58 °C	–	Universal
HUF	GAGCCGCCTGGATACCGC	0.00625	1° PCR 58 °C	231	Human
NewPLFshort	CTATCAGCTTTTGATGTTAG	0.0375	2° PCR 53 °C	–	Plasmodium
Malshort	TCCAATTGCCTTCTG	0.0625	2° PCR 53 °C	215	P. malariae
Falshort	GTTCCCCTAGAATAGTTACA	0.0375	2° PCR 53 °C	344	P. falciparum
Vivshort	AAGGACTTCCAAGCC	0.025	2° PCR 53 °C	457	P. vivax
OvaNew	CCAATTACAAAACCATG	0.0875	2° PCR 53 °C	176	P. ovale
NewPKrev	CGCGGAGGCATC	0.025	2° PCR 53 °C	389	P. knowlesi

^aExpected size of the PCR product between the corresponding Universal/Plasmodium primer with the species specific primer
^bSize depending upon species

ISSN: 1475-2875