Skip to main content

Table 1 Primer sequences of ABC transporters and housekeeping genes of Anopheles stephensi

From: Gene silencing through RNAi and antisense Vivo-Morpholino increases the efficacy of pyrethroids on larvae of Anopheles stephensi

Gene Forward primer Reverse primer bp Sources
AnstABCG4 ATGAGCCCATTCGTCCTG AGCGTGGAGAAGAAGCAG 158 [25]
rps7 AGCAGCAGCAGCACTTGATTTG TAAACGGCTTTCTGCGTCACCC 90 [49]
GAPDH GCCGTCGGCAAGGTCATCCC TTCATCGGTCCGTTGGCGGC 166 [50]