Skip to main content

Table 1 Primer pairs used to amplify and sequence Pfcrt and Pfmdr1

From: Analysis of Plasmodium falciparum Pfcrt and Pfmdr1 genes in parasite isolates from asymptomatic individuals in Southeast Nigeria 11 years after withdrawal of chloroquine

Gene Primer Primer sequence PCR Cycling conditions
P. falciparum Genus
P. falciparum
rPLU1 TCAAAGATTAAGCCATGCAAGTGA 25 cycles of 94 °C/1 min, 58 °C/1 min, and 72 °C/2 min
30 cycles of 94 °C/1 min, 58 °C/1 min, and 72 °C/2 min
rPLU5
rFAL1
rFAL2
CCTGTTGTTGCCTTAAACTTC
TTAAACTGGTTTGGGAAAACCAAATATATT
ACACAATGAACTCAATCATGACTACCCGTC
Pfcrt SNPs
Codon
72 and 76
OF P1 5′-GACGAGCGTTATAGAGAATTA-3′ 35 cycles of 94 °C/30 s; 56 °C/30 s; and 62 °C/1 min
OR P2 5′-CCAGTAGTTCTTGTAAGACC-3′
NF P3 5′-GGCTCACGTTTAGGTGGA-3′ 30 cycles of 94 °C/30 s; 56 °C/30 s; and 65 °C/1 min
NR P4 5′-TGAATTTCCCTTTTTATTTCCAAA3′
Pfmdr1 SNPs
Codon
86 and 184
OF P5 5′-AGGTTGAAAAAGAGTTGAAC-3′ 30 cycles of 94 °C/30 s; 55 °C/30 s; and 65 °C/1 min
OR P6 5′-ATGACACCACAAACATAAAT-3′
NF P7 5′-ACAAAAAGAGTACCGCTGAAT-3′ 30 cycles of 94 °C/30 s; 60 °C/30 s; and 65 °C/1 min
NR P8 5′AAACGCAAGTAATACATAAAGTC3′
Pfmdr1 SNPs
Codon 1034
1042 & 1246
OF P9 5′-GTGTATTTGCTGTAAGAGCT-3′ 34 cycles of 94 °C/30 s; 55 °C/60 s and 72 °C/1.5 min
OR P10 5′GACATATTAAATAACATGGGTTC
NF P11 5′CAGATGATGAAATGTTTAAAGATC 29 cycles of 94 °C/30 s; 60 °C/30 s; and 65 °C/1 min
NR P12 5′-TAAATAACATGGGTTCTTGACT