Skip to main content

Table 1 PCR primer sequences and amplicon size of G6PD gene

From: Prevalence and distribution of G6PD deficiency: implication for the use of primaquine in malaria treatment in Ethiopia

PCR pair Primer name Primer sequence (5′–3′) Primer position PCR product (bp) Coding region (bp) Exon coverage
1 6284F CAAGGAGTGATTTGGGCAAT 6284    
  6755R AGAGCAAAACTCCGTCTCCA 6755 472 120 Exon 3
2 D-6F AATCTCGGGGCTCTTCTGTCTG 16,237    
  D-1170R GCAACGGCAAGCCTTACATCTG 17,422 1185 365 Exon 4–6
3 D-1880F CTTCGGGAGGGACCTGCAGAG 18,107    
  D-2865R GTGGTGACTTCTCCGGGGTTGA 19,114 1007 379 Exon 7–9
4 G6-5F CCTGAGGGCTGCACATCT 19,356    
  G6-5R GTGTCTTGCTGATGCCACTG 20,096 740 423 Exon 10–11
  1. Primer position can be referred to NCBI accession no. NG_009015.2