Skip to main content

Table 2 Details of the primers used in this study

From: Molecular characteristics of odorant-binding protein 1 in Anopheles maculipennis

Primer nameNucleotide sequence (5′ → 3′)
AnFaTTGTCTCDTGATTGATTTGTCA
AnRaCTTYTCGTCYTCGTGGATTCT
AnFbAGATCCACGARGACGARAAG
AnRbGAAAAATACGGTCTGATTATAG
AmaFGTGTGGATAGTTCTTGGAACGG
AmaRAAGAAATGCATCGCACACTCGC
  1. R = A+G, Y = C+T, D = A+G