Skip to main content

Table 1 Primer sequences and qPCR conditions for varATS assay

From: High cases of submicroscopic Plasmodium falciparum infections in a suburban population of Lagos, Nigeria

Oligonucleotide sequences
 Primer-fw (5′–3′)CCCATACACAACCAATTGGA
 Primer-rev (5′–3′)TTCGCACATATCTCTATGTCTATCT
 Probe (5′–3′)6-FAM-TTTTCCATAAATGGT-NFQ-MGB
qPCR reaction conditions (final concentration in qPCR mix)
 Total volume (μL)20
 DNA volume (μL)5
 TaqMan® Gene Expression Mastermix
 Primer (each)800 nM
 Probe400 nM
qPCR cycling conditions
 Pre-incubation2 min–50 °C
 Initial denaturation10 min–95 °C
 Denaturation15 s–95 °C
 Annealing and elongation1 min–55 °C
 Number of cycles45
Standard material for quantificationgDNA of parasite dilution row
PlatformReal-Time PCR System (Applied Biosystems)