Skip to main content

Table 2 Design of 13 candidate qPCR assays in ascending order by template copy number

From: Template copy number and the sensitivity of quantitative PCR for Plasmodium falciparum in asymptomatic individuals

qPCR assay Fluorescence Forward primer (FP), reverse Primer (RP) and Probe sequences (5′ → 3′)
crt MGB TaqMan FP: GACACCGAAGCTTTAATTTAC
RP: GCAGAAGAACATATTAATAGGAA
Probe: 5′-HEX/TTAGATGCCTGTTC/3′-MGBEc/
crt76K
crt76T
MGB TaqMan FP: TGGTAAATGTGCTCATGTGTTT
RP: AGTTTCGGATGTTACAAAACTATAGT
Probe(K76): 5′-HEX/TGTGTAATGAATAAAATTTTTGCTAA/3′-MGBEc/
Probe(T76): 5′-6-FAM/TGTGTAATGAATACAATTTTTGCTAA/3′-MGBEc/
ldh(a) Standard TaqMan FP: ACGATTTGGCTGGAGCAGAT
RP: TCTCTATTCCATTCTTTGTCACTCTTTC
Probe: 5′-HEX/AGTAATAGTAACAGCTGGATTTACCAAGGCCCCA/3′-IABkFQ/
ldh(b) MGB TaqMan FP: TGGTCATATTAAGAAGAATTGTC
RP: CTGAGATATGTAATACTTCAATC
Probe: 5′-HEX/CCATAACATCTACT/3′-MGBEc/
18SrRNA(a) Standard TaqMan FP: CTTTTGAGAGGTTTTGTTACTTTGAGTAA
RP: TATTCCATGCTGTAGTATTCAAACACAA
Probe: 5′-HEX/TGTTCATAACAGACGGGTAGTCATGATTGAGTTCA/3′-IABkFQ/
18SrRNA(b) MGB TaqMan FP: ATTGCTTTTGAGAGGTTTTGTTACTTT
RP: GCTGTAGTATTCAAACACAATGAACTCAA
Probe: 5′-HEX/CATAACAGACGGGTAGTCAT/3′-MGBEc/
r364(a) PET FP: ACCCCTCGCCTGGTGTTTTT
RP/Probe: 5′-HEX/aggcgcatagcgcctggTCGGGCCCCAAAAATAGGAA
cytB LNA TaqMan FP: TACTAACTTGTTATCCTCTATTCCAGTAGC
RP: CCTTTAACATCAAGACTTAATAGATTTGGA
Probe: 5′-HEX/+ GTG + CTA + CCA + TGT + AAA + TGTAA/3′-IABkFQ/
coxI MGB TaqMan FP: GTCACGCAATATCAATATACTG
RP: CGATCTCTTGTATGGTAATAGG
Probe: 5′-HEX/ATAGAACTCCAGGC/3′-MGBEc/
varATS MGB TaqMan FP: CCCATACACAACCAAYTGGA
RP: TTCGCACATATCTCTATGTCTATCT
Probe: 5′-HEX/TRTTCCATAAATGGT/3′-MGBEc/
r364(b) MGB TaqMan FP: AGTCCATTTTCCCCTAGC
RP: GACCATATAGTAAGTGACCCA
Probe: 5′-HEX/AATTGACATGCACT/3′-MGBEc/
TARE-2 dsDNA-dye FP: CTATGTTGCACTTACATGCAYAAT
RP: TGACCTAAGAAGTAVAATAATGATGA
  1. Information provided in this table includes the abbreviations for each of the 13 qPCR assays, the source of the fluorescent signal in each assay and the sequences of the forward and reverse primers and probes for each assay (beginning on the left with the 5′ end and concluding on the right with the 3′ end for each primer and probe)
  2. MGB, minor groove binder; PET, photo-induced electron transfer; LNA, locked nucleic acid; dsDNA, double-stranded DNA; 6-FAM, 6-carboxyfluorescein fluorescent dye; HEX, hexachloro-fluorescein fluorescent dye; IABkFQ, Iowa Black fluorescent quencher; MGBEc, MGB Eclipse® fluorescent quencher