Skip to main content

Table 1 Primers and probe sequences used for QuantiFast™ real-time PCR detection of Plasmodium species [20, 24] and nested PCR detection of P. knowlesi [22] in this study

From: Comparative evaluation of two commercial real-time PCR kits (QuantiFast™ and abTES™) for the detection of Plasmodium knowlesi and other Plasmodium species in Sabah, Malaysia

Species Primer or probe Sequence (5′–3′)a
P. knowlesi
 Forward Plasmo1 GTTAAGGGAGTGAAGACGATCAGA
 Reverse Plasmo2 AACCCAAAGACTTTGATTTCTCATAA
 RT-probe Pkprobe FAM-CTCTCCGGAGATTAGAACTCTTAGATTGCT-BHQ-1
P. falciparumb
 Forward Fal-F CCGACTAGGTGTTGGATGAAAGTGTTAA
 RT-probe Falcprobe Cy5-AGCAATCTAAAAGTCACCTCGAAAGATGACT-BHQ-1
P. vivaxb
 Forward Viv-F CCGACTAGGCTTTGGATGAAAGATTTTA
 RT-probe Vivprobe TR-AGCAATCTAAGAATAAACTCCGAAGAGAAAATTCT-BHQ-2
P. malariaeb
 Forward Mal-F CCGACTAGGTGTTGGATGATAGAGTAAA
 RT-probe Malaprobe FAM-CTATCTAAAAGAAACACTCAT-MGBNFQ
Validated reference PCR for P. knowlesi detection
 Nest 1; Forward PkF1160 GATGCCTCCGCGTATCGAC
 Nest 1; Reverse PKR1150 GAGTTCTAATCTCCGGAGAGAAAAGA
 Nest 2; Forward PKF1140 GATTCATCTATTAAAAATTTGCTTC
 Nest 2; Reverse PKR1150 Same as reverse primer used in Nest 1
  1. aMGBNFQ: minor groove binding non-fluorescent quencher; BHQ: black hole quencher; Cy5: cyanine; FAM: carboxyfluorescein; TR: Texas Red
  2. bThe Plasmo2 reverse primer was also used for P. falciparum, P. vivax and P. malariae