Skip to main content

Table 1 Primers and probes for Plasmodium species detection

From: Molecular epidemiological surveillance of Africa and Asia imported malaria in Wuhan, Central China: comparison of diagnostic tools during 2011–2018

Method Species Primer Sequence (5′–3′) Length (bp) References
Nested PCR Plasmodium sp. rPLU1 TCAAAGATTAAGCCATGCAAGTGA 1670 [43]
rPLU5 CCTGTTGTTGCCTTAAACTTC
P. falciparum rFAL1 TTAAACTGGTTTGGGAAAACCAAATATATT 205
rFAL2 ACACAATGAACTCAATCATGACTACCCGTC
P. vivax rPVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC 121
rPVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
P. malariae rMAL1 ATAACATAGTTGTACGTTAAGAATAACCGC 145
rMAL2 AAAATTCCCATGCATAAAAAATTATACAAA
P. ovale rOVA1WC TGTAGTATTCAAACGCAGT 659–662
rOVA2WC TATGTACTTGTTAAGCCTTT
P. ovale curtisi rOVA1 ATCTCTTTTGCTATTTTTTAGTATTGGAGA 800 [44]
rOVA2 GGAAAAGGACACATTAATTGTATCCTAGTG
P. ovale wallikeri rOVA1v ATCTCCTTTACTTTTTGTACTGGAGA 780
rOVA2v GGAAAAGGACACTATAATGTATCCTAATA
Real-time PCR Plasmodium sp. Plasmo 1 GTTAAGGGAGTGAAGACGATCAGA   [35]
Plasmo 2 AACCCAAAGACTTTGATTTCTCATAA  
P. falciparum P. fal-probe FAM-AGCAATCTAAAAGTCACCTCGAAAGATGACT-TAMRA  
P. vivax P. v-probe HEX-AGCAATCTAAGAATAAACTCCGAAGAGAAAATTCT-TAMRA  
P. malariae P. m-probe FAM-CTATCTAAAAGAAACACTCAT-MGB  
P. ovale P. o-probe HEX-CGAAAGGAATTTTCTTATT-MGB  
P. ovale POF ATAAACTATGCCGACTAGGTT   [42]
POR ACTTTGATTTCTCATAAGGTACT  
P. ovale curtisi POC-probe FAM-TTCCTTTCGGGGAAATTTCTTAGA-BHQ1  
P. ovale wallikeri POW-probe HEX-AATTCCTTTTGGAAATTTCTTAGATTG-BHQ1