Skip to main content

Table 1 Primer sequences used for the nested PCR and restriction enzymes used for the RLFP

From: Prevalence and factors associated with carriage of Pfmdr1 polymorphisms among pregnant women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) and artemether-lumefantrine for malaria treatment in Burkina Faso

Primer name Sequence Restriction enzyme
Nested1 forward Pfmdr1 86 (MDR-A1) TGTTGAAAGATGGGTAAAGAGCAGAAAGAG AflIII (NEB)
Nested1 reverse Pfmdr1 86 (MDR-A3) TACTTTCTTATTACATATGACACCACAAACA
Nested2 forward Pfmdr1 86 (MDR-A4) AAAGATGGTAACCTCAGTATCAAAGAAGAG
Nested2 reverse Pfmdr1 86 (MDR-A2) GTCAAACGTGCATTTTTTATTAATGACCAttTA
Nested1 forward Pfmdr1 184 (MDR-A1) TGTTGAAAGATGGGTAAAGAGCAGAAAGAG DraI (NEB)
Nested1 reverse Pfmdr1 184 (MDR-A3) TACTTTCTTATTACATATGACACCACAAACA
Nested2 forward Pfmdr1 184 (MDR-A4) AAAGATGGTAACCTCAGTATCAAAGAAGAG
Nested2 reverse Pfmdr1 184 (MDR-A2) GTCAAACGTGCATTTTTTATTAATGACCAttTA
Nested1 forward Pfmdr1 1246 (MDR-O1) AGAAGATTATTTCTGTAATTTGATACAAAAAGC EcoRV (NEB)
Nested1 reverse Pfmdr1 1246 (MDR-O2) ATGATTCGATAAATTCATCTATAGCAGCAA
Nested2 forward Pfmdr1 1246 (1246F) ATGATCACATTATATTAAAAAATGATATGACAAAT
Nested1 reverse Pfmdr1 1246 (MDR-O2) ATGATTCGATAAATTCATCTATAGCAGCAA