Skip to main content

Table 1 Primer sets for polymerase chain reaction

From: Haptoglobin gene diversity and incidence of uncomplicated malaria among children in Iganga, Uganda

Reaction Target alleles Primer pair Oligonucleotide sequence (5′-3′) Product size (bp)
Reaction 2 Hp2 F3 CAGGAGTATACACCTTAAATG 935
C42 TTACACTGGTAGCGAACCGA
Reaction S Hp1S C51 GCAATGATGTCACGGATATC 1.2 kb
S2 TTATCCACTGCTTCTCATTG
Reaction F Hp1F F3 CAGGAGTATACACCTTAAATG 1.4 kb
C72 AATTTAAAATTGGCATTTCGCC
  1. bp Base pair