Skip to main content

Table 1 List of primers used for plasmodium species identification using nested real-time PCR

From: Molecular surveillance and temporal monitoring of malaria parasites in focal Vietnamese provinces

Genus/species Target Primer ID Primer sequence (5′ – 3′) 5′ modified 3′ modified References
Plasmodium 18S rRNA gene rPLU6-F TTAAAATTGTTGCAGTTAAAACG    [21]
   rPLU5-R CCTGTTGTTGCCTTAAACTTC    
P. falciparum 18S rRNA type S PF-F ATTGCTTTTGAGAGGTTTTGTTACTTT    [22]
   PF-R GCTGTAGTATTCAAACACAATGAACTCAA    
   PF-Probe CATAACAGACGGGTAGTCAT HEX MGBEQ  
P. vivax 18S rRNA type A VIV-F GCAACGCTTCTAGCTTAATCCAC    [23]
   VIV-R CAAGCCGAAGCAAAGAAAGTCC    
   VIV-Probe ACTTTGTGCGCATTTTGCTA HEX MGBEQ  
P. malariae 18S rRNA gene PM-F GGTGTTGGATGATAGAGTAA    [20]
   PM-R CCCAAAGACTTTGATTTCTC    
   PM-Probe AGGAAGCTATCTAAAAGAAACACTCAT HEX BHQ-1  
P. ovale curtisi 18S rRNA gene POS-F ATTTCAAAGAGTCATGGCGTTTCTG    [20]
   POS-R TTGTAAAGGAGACACTTTCTTGAAATCG    
   POS-Probe CTCCTTGGTCGATCTGCCCAGCACT FAM BHQ-1 [20]
P. ovale wallikeri 18S rRNA gene POS-F ATTTCAAAGAGTCATGGCGTTTCTG    
   POW-R TGTAAAGGAGACAACTTTCTTGGAGCTA    
   POW-Probe TTGATCGCCCAGCACTGACCATCT HEX BHQ-1  
  1. HEX: 6-hexachlorofluorescein; FAM: 6-carboxyfluorescein; MGBEQ: minor groove binder eclipse quencher. BHQ-1: black hole quencher-1. rRNA: ribosomal ribonucleic acid