Skip to main content

Table 1 Brief information about PCR

From: RDL mutations in Guangxi Anopheles sinensis populations along the China–Vietnam border: distribution frequency and evolutionary origin of A296S resistance allele

Primer nameSequenceAnnealing temperature (°C)Amplicon size (bp)
ARE-7FAGTTTGTACGTTCGATGGGTTA62476
7I-RGGCAACAGTAAGCTATGTCGA
8F-1ATAATCGCCCCGGATCACC56167
8R-1CCTGCTGCTTCTTCTGTTCC