S. no. | Locus | Primer | Primer sequence | Tm (°C) |
---|
1 | Primarya | PMMSP1full_F2 (N1F) | GAATTGTCGAAAGCATTGGT | 54.2 |
PMMSP1full_OR2 (N1R) | TCAACTTCTTTCTTTTCTGCTTC | 55.0 |
2 | Secondaryb | PMMSP1VNTR_1F (NF2) | CCAAGCATACGGAACAGGAG | 58.8 |
PMMSP1VNTR_1R (NR2) | CAAATCTAATTGGTCGCACTTC | 56.2 |
- Thermal cycling profile: initial denaturation step at 95 °C for 5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 2 min and extension at 72 °C for 2 min then last extension step at 72 °C for 5 min. 2 µL of each primary reaction was used as template for the 100 µL secondary PCR reaction. Thermal cycling profile: Initial denaturation step at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 2 min and extension at 72 °C for 2 min then final extension step at 72 °C for 5 min
- aPrimary and bSecondary set of primers were used to amplify the pmmsp1 gene segment of Plasmodium malariae