Skip to main content

Table 2 Primary and secondary primers used for amplification of pmmsp1 gene located on chromosome seven using semi-nested PCR

From: Polymorphic markers for identification of parasite population in Plasmodium malariae

S. no.LocusPrimerPrimer sequenceTm (°C)
1PrimaryaPMMSP1full_F2 (N1F)GAATTGTCGAAAGCATTGGT54.2
PMMSP1full_OR2 (N1R)TCAACTTCTTTCTTTTCTGCTTC55.0
2SecondarybPMMSP1VNTR_1F (NF2)CCAAGCATACGGAACAGGAG58.8
PMMSP1VNTR_1R (NR2)CAAATCTAATTGGTCGCACTTC56.2
  1. Thermal cycling profile: initial denaturation step at 95 °C for 5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 2 min and extension at 72 °C for 2 min then last extension step at 72 °C for 5 min. 2 µL of each primary reaction was used as template for the 100 µL secondary PCR reaction. Thermal cycling profile: Initial denaturation step at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 2 min and extension at 72 °C for 2 min then final extension step at 72 °C for 5 min
  2. aPrimary and bSecondary set of primers were used to amplify the pmmsp1 gene segment of Plasmodium malariae