Skip to main content

Table 1 Oligonucleotide primers and PCR conditions used in this study

From: High frequency of the Duffy-negative genotype and absence of Plasmodium vivax infections in Ghana

Purpose [Ref.] Primer name Sequence (5′–3′) Amplicon (bp) PCR conditions
Plasmodium sp. [32] rPLU5 CCTGTTGTTGCCTTAAACTTC 1100 94 °C × 5 min, 35 cycles (94 °C × 60 s, 60 °C × 90 s, 68 °C × 60 s), 68 °C × 10 min
rPLU6 TTAAAATTGTTGCAGTTAAAAC
P. falciparum [32] rFAL1 TTAAACTGGTTTGGGAAAACCAAATATATT 205 94 °C × 5 min, 35 cycles (94 °C × 60 s, 55 °C × 90 s, 68 °C × 60 s), 68 °C × 10 min
rFAL2 ACACAATGAACTCAATCATGACTACCCGTC
P. vivax [32] rVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC 120 94 °C × 5 min, 35 cycles (94 °C × 60 s, 55 °C × 90 s, 68 °C × 60 s), 68 °C × 10 min
rVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
P. malariae [32] rMAL1 ATAACATAGTTGTACGTTAAGAATAACCGC 144 94 °C × 5 min, 35 cycles (94 °C × 60 s, 55 °C × 90 s, 68 °C × 60 s), 68 °C × 10 min
rMAL2 AAAATTCCCATGCATAAAAAATTATACAAA
P. ovale [32] rOVA1 ATCTCTTTTGCTATTTTTTAGTATTGGAGA 800 94 °C × 5 min, 35 cycles (94 °C × 60 s, 55 °C × 90 s, 68 °C × 60 s), 68 °C × 10 min
rOVA2 GAAAAGGACACATTAATTGTATCCTAGTG
P. vivax [33] VivF TCCATCCTGTTGGTGGACTT 700 94 °C × 5 min, 35 cycles (94 °C × 60 s, 60 °C × 90 s, 68 °C × 60 s), 68 °C × 10 min
VivR TCACAACGTTAAATATGCCAG
Duffy genotypes [34] GATAFY2 CTCATTAGTCCTTGGCTCTTAC 711 94 °C for 5 min, 40 cycles (94 °C × 30 s, 56 °C × 30 s, 68 °C × 60 s), 68 °C × 10 min
FYAB2 CTCATTAGTCCTTGGCTCTTAT
FYAREV AGCTGCTTCCAGGTTGGCAC
FYBREV AGCTGCTTCCAGGTTGGCAT
Human growth hormone gene [35] HGH-F TGCCTTCCCAACCATTCCCTTA 434 94 °C for 5 min, 40 cycles (94 °C × 30 s, 56 °C × 30 s, 68 °C × 60 s), 68 °C × 10 min
HGH-R CCACTCACGGATTTCTGTTGTGTTTC
\