Skip to main content

Table 1 Primers involved in this study

From: Validation of SYBR green I based closed‐tube loop‐mediated isothermal amplification (LAMP) assay for diagnosis of knowlesi malaria

Name of primers Sequence (5′ to 3′) References
PCR primers  
 rPLU1 TCAAAGATTAAGCCATGCAAGTGA Snounou et al. [7
 rPLU5 CCTGTTGTTGCCTTAAACTCC
 PkF1140 GATTCATCTATTAAAAATTTGCTTC Imwong et al. [9]
 PkR1550 GAGTTCTAATCTCCGGAGAGAAAAGA
LAMP primers  
 FIP GTTGTTGCCTTAAACTTCCTTGTGTTCTTGATTGTAAAGCTTCTTAGAGG Lau et al. [10]
 BIP TGATGTCCTTAGATGAACTAGGCTTTGCAAGCAGCTAAAATCGT
 FLP TAGACACACATCGTT
 BLP GCACGCGTGCTACACT
 F3 CCATCTATTTCTTTTTTGCGTATG
 B3 CAGTGGAGGAAAAGTACGAA