Skip to main content

Table 1 HRM primers used in this study

From: Glucose-6-phosphate dehydrogenase mutations in malaria endemic area of Thailand by multiplexed high‐resolution melting curve analysis

Reaction system Primer name G6PD variant Primer sequence (from 5’ to 3’) Primer concentration (nM) Amplicon size (bp) Tm of PCR
product (°C)
1 A95G_F Gaohe TTCCATCAGTCGGATACACG 600 100 81.05
  A95G_R (His32Arg) AGGCATGGAGCAGGCACTTC 600   
  G487A_F Mahidol TCCGGGCTCCCAGCAGAA 400 87 84.80
  G487A_R (Gly163Ser) GGTTGGACAGCCGGTCA 400   
  G871A_F Viangchan GGCTTTCTCTCAGGTCAAGA 400 66 78.32
  G871A_R (Val291Met) CCCAGGACCACATTGTTGGC 400   
  G1376T_F Canton CCTCAGCGACGAGCTCCT 600 99 83.65
  G1376T_R (Arg459Leu) CTGCCATAAATATAGGGGATGG 600   
2 G392T_F Chinese-4 CATGAATGCCCTCCACCTGGT 200 87 85.05
  G392T_R (Gly131Val) TTCTTGGTGACGGCCTCGTA 200   
  C1024T_F Chinese-5 CACTTTTGCAGCCGTCGTCT 400 99 83.10
  C1024T_R (Leu342Phe) CACACAGGGCATGCCCAGTT 400   
  C1360T_F Union GAGCCAGATGCACTTCGTGT 200 127 87.67
  C1360T_R (Arg454Cys) GAGGGGACATAGTATGGCTT 200   
  G1388A_F Kaiping GCTCCGTGAGGCCTGGCA 400 57 78.97
  G1388A_R (Arg463His) TTCTCCAGCTCAATCTGGTGC 400