Skip to main content

Table 2 Sequencing primers used in this study

From: Glucose-6-phosphate dehydrogenase mutations in malaria endemic area of Thailand by multiplexed high‐resolution melting curve analysis

Primer name Primer sequence (from 5’ to 3’)
Exon2F GGGCAATCAGGTGTCACC
Exon2R GGCTTTTAAGATTGGGGCCT
Exon3F AGACATGCTTGTGGCCCAGTA
Exon5F GGACACTGACTTCTGAGGGCA
Exon5R AAGGGAGGGCAACGGCAA
Exon6F CACGGGGGCGAGGAGGTT
Exon8F CGGTTTTATGATTCAGTGATA
Exon8R AGGGCATGCTCCTGGGGA
Exon9F GTGAGCAGAGCCAAGCAG
Exon11F CAGATACAAGGTGCCCTACAG
Exon13R TGGCGGGGGTGGAGGTGG