Skip to main content

Table. 2 Designed primer sets used for predicting relative species composition ratios

From: Prediction of species composition ratios in pooled specimens of the Anopheles Hyrcanus group using quantitative sequencing

Gene Primer name Sequence (5′–3′) Size (bp)
COI An_COI-F CTTTAAGTATTCTAATTCGAGCTG 594
An_COI-R TAAAATWGGRTCTCCTCCTCC
ITS2 Anskb_ITS2-F CAGACAAGTAGAAAGGGCTGT 234a/235b/238c
Anskb_ITS2-R ACAAATCTGGGTAGTGTTCTCT
  1. aAnk = An. kleini
  2. bAnb = An. belenrae
  3. cAns = An. sinensis