Skip to main content

Table 1 Sequence of primers used in nested PCR for the amplification of the pfcrt and pfmdr1 genes

From: Assessment of Plasmodium falciparum anti-malarial drug resistance markers in pfcrt and pfmdr1 genes in isolates from Honduras and Nicaragua, 2018–2021

Gene Primer Sequence 5′- 3′ Size bp References
pfcrt AL6821 AGCAAAAATGACGAGCGTTATAG 559 [11]
AL6822 ATTGGTAGGTGGAATAGATTCTC
AL5631 TTTTTCCCTTGTCGACCTTAAC 264
AL5632 AGGAATAAACAATAAAGAACATAATCATAC
pfmdr1 SNPs 86, 184 MDR1-1F TTAAATGTTTACCTGCACAACATAGAAAATT 612 [17]
MDR1-1R CTCCACAATAACTTGCAACAGTTCTTA
MDR1-2F TGTATGTGCTGTATTATCAGGA 526
MDR1-2R CTCTTCTATAATGGACATGGTA
pfmdr1 SNPs 1034, 1046 1042-A GTCGAAAAGACTATGAAACGTAGA 711 [17]
1042-C CTCAAATGATAATTTTGCAT
1042-B GATCCAAGTTTTTTAATACA
1042-C CTCAAATGATAATTTTGCAT
pfmdr1 SNPs 1246 1246-A GTGGAAAATCAACTTTTATGA 500 [17]
1246-B TTAGGTTCTCTTAATAATGCT
1246-C GACTTGAAAAATGATCACATT 412
1246-D GTCCACCTGATATGCTTTT