Skip to main content

Table 1 Oligonucleotide primers and PCR reaction conditions for SNPs detection in pfATPase6, pftctp, pfmdr 1 and pfcrt genes

From: Plasmodium falciparum isolates from southern Ghana exhibit polymorphisms in the SERCA-type PfATPase6 though sensitive to artesunate in vitro

Gene
Primer pair
Sequence 5' 3' PCR product size (bp) PCR reaction conditions
pfATPase6    
   atp6-1F tcatctaccgctattgtatgtgg 777 94oC 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40''); 72°C 5'
   atp6-1R attcctcttagcaccactcct   
   atp6-2F tcaccaaggggtatcaacaa 692 94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40''); 72°C 5'
   atp6-2R tggcataatctaattgctcttcc   
   atp6-3F atgtatagctgttgtaatcaacctaga 822 94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40'); 72°C 5'
   atp6-3R tcactatatggatcagcttcatca   
   atp6-4F ccagtacattgaatgaaaatg 605 94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 40''); 72°C 5'
   atp6-4R acgtggtggatcaataatacct   
pftctp    
   pftctp-1F atgaaagtatttaaagacgtt 462 94°C 5' followed by 40 cycles (94°C 15'';
   pftctp-1R ttcttctcctttataataagaat   50°C 30''; 72°C 40''); 72°C 5'
pfmdr1    
   mdr1-1F tgaacaaaaagagtaccgctga 823 94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 1'); 72°C 5'
   mdr1-1R ccataccaaaaaccgaatgc   
   mdr1-2F caagcggagtttttgcattt 1062 94°C 5' followed by 40 cycles (94°C 15''; 55°C 30''; 72°C 1'); 72°C 5'
   mdr1-2R ttctctgtttttgtccacctga   
pfcrt    
   pfcrt-1'F atggctcacgtttaggtgga   94°C 5' followed by 40 cycles (94°C 15''; 55°C 15''; 72°C 40''); 72°C 2'
   pfcrt-2R aaagcttcggtgtcgttc   
   pfcrt-1F tgtgctcatgtgtttaaactt   94°C 5' followed by 25 cycles (94°C 15''; 48°C 30''; 72°C 20''); 72°C 5'
   pfcrt-2'R ggaatagattctcttataaatcc 282  
  1. The oligonucleotide primers were supplied by Greiner Bio-One Co., Ltd. Primer pairings of pfATPase6 gene, 1F & 1R, 2F & 2R, 3F & 3R, 4F & 4R were used resulting in the corresponding PCR product sizes. For the pfcrt primers, nested PCR was carried out with 1'F & 2R in the first reaction, followed by 1F & 2'R in the second reaction.