Skip to main content

Advertisement

Table 1 Plasmodium vivax primers list and their annealing temperature

From: Plasmodium vivax lineages: geographical distribution, tandem repeat polymorphism, and phylogenetic relationship

Gene/locus Primer name Primer sequences (5'-3') Annealing Tm (°C)
18S SSU rRNA SSU-F ATGAACGAGATCTTAACCTGC 65/55
  SSU-R CATCACGATATGTA5TGATAAAGATTACC  
MiniSat-1 Mini1-F ATGCTTCATTGGGTCCAC 50
  Mini1-R TCGAACAGGACAATGCTG  
MiniSat-2 Mini2-F TCACCGGTGGGTCCTTCG 50
  Mini2-R GCAGCGACGAACCGTCAC  
MiniSat-5 Mini5-F CAACCTGCAGAGCAATGC 55
  Mini5-R ACGTTTCTGGGCGACTTC  
MiniSat-6 Mini6-F TTGTGCTGTGCTGTGCTG 55
  Mini6-R ACGGTTGGTATGGTCAGG  
MiniSat-8 Mini8-F AGCCACAATCCCAACTGC 52
  Mini8-R TGGTGGTTGTGACTCTAG  
MiniSat-11 Mini11-F GGCACAGTGATCATATTCG 55
  Mini11-R GCGGGTACATAACGCATG  
MiniSat-13 Mini13-F GGCACATGAACTTTTCGG 52
  Mini13-R TTCACCATGGTCCCTTCG  
MiniSat-14 Mini14-F CTCTTCGTCGCGTCCAGG 52
  Mini14-R CAGGGTATCCACGACCAG  
MiniSat-16 Mini16-F TATGTACTACCTCCACCC 52
  Mini16-R AGCGCGAATATGCATACG  
PvCDPK CDPK-F CGCCTCTTTTTCGAGCCC 55
  CDPK-R CTGCGCCTTCCGCGTCTT  
  1. High-resolution metaphor agarose (3-4% gel) was used for mini-satellite allele sizing. A fixed electrophoresis protocol (2 h @ 80 V) was used for all experiments for consistency in allele sizing. A 20 bp DNA ladder and Genetool software were used (SynGene Inc., UK) for allele sizing.