Skip to main content

Table 1 Primers used for pfcrt sequencing and real-time PCR quantification

From: Sequence and gene expression of chloroquine resistance transporter (pfcrt) in the association of in vitro drugs resistance of Plasmodium falciparum

Exon 1-2  
Primary  
   E1/2-F CGACATTCCGATATATTATATTTTTAGAC
   E1/2-R TATATGTGTAATGTTTTATATTGG
Nested  
   E1/2-NF CCGTTAATAATAAATACACGCAG
   E1/2-NR AATGTTTTATATTGGTAGGTGG
Exon 3-8  
Primary  
   E3/8-F CCACCTACCAATATAAAACATTAC
   E3/8-R GTTAAAATATATATAAATGTCTC
Nested  
   E3/8-NF TATATATATATGTATGTATGTTG
   E3/8-NR AATGTCTCTTATAATTTTGAAATT
Exon 9-13  
Primary  
   E9/13-F CTTATAATAAAATTTCAAAATTATAAGAGAC
   E9/13-R GAGATCTCTATACCTTCAACATTATTCC
Nested  
   E9/13-NF GAGACATTTATATATATTTTAAC
   E9/13-NR CCTTATAAAGTGTAATGCG
pfcrt RT-PCR  
pfcrt-F CTTTATTTGTATGATTATGTTCTTTATTGTTTATTCCTTATTTGGA
pfcrt-R AACAGGCATCTAACATGGATATAGCAAA
pfcrt-probe TCGGTGTCGTTCTTTTG
pfmdr RT-PCR  
pfmdr-F GCATTCGGTTTTTGGTATGGTACAA
pfmdr-R CCTAATAAAATGGATATAACTGAGGCACCA
pfmdr-probe ACGAATCAATACCCCAATAAT
EF-1a RT-PCR  
EF-1a-F GGCAGAAAGAGAAAGAGGTATTACCA
EF-1a-R CCTGGTGCATCAATGACAGTAAAGA
EF-1a-probe TTATGGAAATTTGAAACCCC