Skip to main content

Table 1 PCR primers used for amplification of Pfs25 and Pvs25

From: Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR

Gene target Primers Sequences (5′ → 3′) Nucleotide positions Product size (bp)
Primary PCR     
Pfs25 and Pvs25 FV25F0 GAAGATACATGTGAAGAAAAA 237–257* or 163–183# 264 for P. falciparum
  FV25R0 ATTGGGAACTTTGCCAATA 482–500* or 414–432# 270 for P. vivax
Secondary PCR     
Pfs25 F25F1 AAATGTGACGAAAAGACTG 264–281* 201
  F25R1 AGTTTTAACAGGATTGCTTGTATC 441–464*  
Pvs25 V25F1 ACCCTAGGCAAAGCATG 202–218# 115
  V25R1 CAAGTGTCTTCCTTCAAAGT 298–317#  
  1. * and # after GenBankTM accession numbers X07802 and GU256271 for Pfs25 and Pvs25, respectively.