Skip to main content

Advertisement

Table 1 PCR primers used for the detection and identification of Plasmodium sp

From: Natural Plasmodium infection in monkeys in the state of Rondônia (Brazilian Western Amazon)

Primer Sequence Ref.
1st PCR   This work
plgen18SF TATTAAAATTGTTGCAGTTAAARCG  
plgen18SR ATCTGTCAATCCTACTCTTGTC  
2nd PCRa   This work
fal18SF GAATCCGATGTTTCATTTAAACTGG  
viv18SF TAACGCCGTTAGCTAGATCCAC  
bra18SF GTTAAAACAGTTTCTGTGTTTGAATA  
sim18SF AGATTTTCTGGAGACAAACAACTGC  
CSPb   This work
mbraCSPF CATGAAGAAGTTATTCTGTCTTAGC  
mbraCSPR TTAGTGAAAGAGTATTAAGACTAAAAC  
MSP-1b   This work
mbraMSP1F ATGAAGATTATGAACAACTTATTCAAAAG  
mbraMSP1R CATCTGACCCTGATTCACTAGG  
  1. a PCR primers designed for the 18S rRNA genes of Plasmodium species observed in South America (P. falciparum, P. vivax, P. malariae/brasilianum and P. simium) and based on sequences deposited in GenBank.
  2. b Primers based on CSP and MSP1 sequences of P. malariae/P. brasilianum deposited in GenBank.