Skip to main content

Table 1 Primer sequences for detection of Plasmodium falciparum DNA

From: Detection of a substantial number of sub-microscopic Plasmodium falciparum infections by polymerase chain reaction: a potential threat to malaria control and diagnosis in Ethiopia

Target name PCR Sequence (5’-3’)
CRTP1 Outer Forward CCGTTAATAATAAATACACGCAG
CRTP2 Outer Reverse CGGATGTTACAAAACTATAGTTACC
CRTD1 Nested Forward TGTGCTCATGTGTTTAAACTT
CRTD2 Nested Reverse CAAAACTATAGTTACCAATTTTG